Welcome to my world...

A Dog's purpose

2008-07-23T12:34:00.001-04:00

Dog's Purpose (from a 6-year-old)
Being a veterinarian, I had been called to examine a ten-year-old Irish Wolfhound named Belker. The dog's owners, Ron, his wife, Lisa, and their little boy, Shane, were all very attached to Belker, and they were hoping for a miracle.

I examined Belker and found he was dying of cancer. I told the family we couldn't do anything for Belker, and offered to perform the euthanasia procedure for the old dog in their home.
As we made arrangements, Ron and Lisa told me they thought it would be good for six-year-old Shane to observe the procedure. They felt as though Shane might learn something from the experience.

The next day, I felt the familiar catch in my throat as Belker's family surrounded him. Shane seemed so calm, petting the old dog for the last time, that I wondered if he understood what was going on. Within a few minutes, Belker slipped peacefully away.
The little b oy seemed to accept Belker's transition without any
difficulty or confusion. We sat together for a while after Belker's death, wondering aloud about the sad fact that animal lives are shorter than human lives. Shane, who had been listening quietly, piped up, "I know why."

Startled, we all turned to him. What came out of his mouth next stunned me. I'd never heard a more comforting explanation. He said, "People are born so that they can learn how to live a good life -- like loving everybody all the time and being nice, right?" The six-year-old continued, "Well, dogs already know how to do that, so they don't have to stay as long."

Live simply.
Love generously.
Care deeply.
Speak kindly.

Remember, if a dog was the teacher you would learn things like:
When loved ones come home, always run to greet them.
Never pass up the opportunity to go for a joyride.
Allow the experience of fresh air and the wind in your face to be pure ec stasy.
Take naps.
Stretch before rising.
Run, romp, and play daily.
Thrive on attention and let people touch you.
Avoid biting when a simple growl will do.
On warm days, stop to lie on your back on the grass.
On hot days, drink lots of water and lie under a shady tree.
When you're happy, dance around and wag your entire body.
Delight in the simple joy of a long walk.
Eat with gusto and enthusiasm. Stop when you have had enough.
Be loyal. Never pretend to be something you're not.
If what you want lies buried, dig until you find it.
When someone is having a bad day, be silent, sit close by and nuzzle them gently.
Be always grateful for each new day.

....Life isn't about waiting for the storm to pass.
It's about learning to dance in the rain.

Think before you speak (thanks Kim)

2008-07-15T14:51:00.000-04:00

Here are six reasons why you should think before you speak -
the last one is great!
Have you ever spoken and wished that you could
immediately take the words back...
or that you could crawl into a hole?
Here are the Testimonials of a few people who did....

FIRST TESTIMONY:
I walked into a hair salon with my husband and three kids in tow
and asked loudly,
'How much do you charge for a shampoo and a blow job?'
I turned around and walked back out and never went back
My husband didn't say a word...
he knew better.

SECOND TESTIMONY:
I was at the golf store comparing differe nt kinds of golf balls.
I was unhappy with the women's type I had been using.
After browsing for several minutes,
I was approached by one of the good-looking gentlemen who works at the store.
He asked if he could help me.
Without thinking, I looked at him and said, 'I think I like playing with mens' balls.

THIRD TESTIMONY:
My sister and I were at the mall and
passed by a store that sold a
variety of candy and nuts.
As we were looking at the display case,
the boy behind the counter asked if we needed any help.
I replied, 'No, I'm just looking at your nuts.'
My sister started to laugh hysterically.
The boy grinned, and I turned beet-red and walked away.
To this day,
my sister has never let me forget.

FOURTH TESTIMONY :
While in line at the bank one afternoon,
my toddler decided to release
some pent-up energy and ran amok.
I was finally able to grab hold of
her after receiving looks of disgust
and annoyance from other patrons.
I told her that if she did not start behaving
'right now' she would be punished.
To my horror, she looked me in the eye and said in a voice just as threatening,
'If you don't let me go right now,
I will tell Grandma that I saw you
kissing Daddy's pee-pee last night!'
The silence was deafening after this enlightening exchange.
Even the tellers stopped what they were doing.
I mustered up the last of my dignity and
walked out of the bank with m y daughter in tow.
The last thing I heard when the door closed behind me, were screams of laughter

FIFTH TESTIMONY:
Have you ever asked your child a question too many times?
My three-year-old son had a lot of problems with potty training and I was on him constantly.
One day we stopped at Taco Bell for a quick lunch, in between errands
It was very busy, with a full dining room.
While enjoying my taco,
I smelled something funny,
so of course I checked
my seven-month-old daughter, she was clean.
The realized that Danny
had not asked to go potty in a while.
I asked him if he needed to go,
and he said 'No' .
I kept thinking
'Oh Lord, that child has had an accident, and I don't have any clothes with me.'
Then I said,
'Danny, are you SURE you didn't have an accident?'
'No,' he replied.
I just KNEW that he must have had an accident, because the smell was getting worse.
Soooooo, I asked one more time, 'Danny did you have an accident ? This time he jumped up, yanked down his pants,
bent over, spread his cheeks
and yelled
'SEE MOM, IT'S JUST FARTS!!'
While 30 people nearly choked to death on their tacos laughing,
he calmly pulled up his pants and sat down.
An old couple made me feel better,
thanking me for the best laugh they'd ever had!

LAST BUT NOT LEAST TESTIMONY:
This had most of the state of Michigan laughing for 2 days
and a very embarrassed female news anchor who will,
in the future, likely think before she speaks.
What happens when you predict snow but don't get any!
We had a female news anchor that,
the day after it was supposed to have snowed and didn't,
turned to the weatherman and asked:
'So Bob, where's that 8 inches you promised me last night?'
Not only did HE have to leave the set,
but half the crew did too they were laughing so hard!
Now, didn't that feel good?

My encounter with a wasp

2008-07-13T11:31:00.004-04:00

It all started as a lazy Saturday afternoon, I figured I'd go in the yard and pull some weeds. Well I'm out there for about 20 mins ALONE as that wonderful man of mine is in the house watching tv. I go inside and say to him "ya think you might want to get off your ass and help me??" (which probably saved my life as you'll see later). So, we're both out there pulling weeds and there's a sewer drain right next to the sidewalk where I was pulling the weeds. Now, I've thrown weeds down there many times before so what would make this time any different. I go over to the drain and begin to throw the weeds down there. All of a sudden I feel this pain in my wrist and I'm like, "damn it I got a thorn in my wrist from the weeds." Umm no, the pain then shoots up to my middle finger, and I'm thinking "what the hell 2 thorns?" The whole time I am looking at my wrist and nothing else. Within 5 seconds the pain is excruciating and I scream "OWWWWWWWWWWWWWWWWWWWWHHHH", which gets Tom's attention. He looks at me and screams "It's wasps, you were stung, RUNNNNNNNNNNNNNNNNNN". I start running into the house swatting behind my head in case they are there. I've never been stung before and all I can say is, wow, it FREAKIN HURTS!!!!!!!!!! Tom comes running in the house and I am SCREAMING, "HELP ME IT HURTS!!!!!!!" He then proceeds to bring me BACK outside (the last place I wanted to be) and throws MUD on it. ???!???? Yeah, did not help what so ever, and as Lisa explained, probably increased the chance of infection. To make a long story short, my wrist blew up like a balloon and turned bright red which lasted for about 5 hours or so. Since this was the first time I was ever stung it's kind of scary wondering if you're allergic and are going to die. Anyway, we discovered that there's a wasp's nest inside the sewer. Imagine if I was out there alone? I wasn't paying attention to anything but my wrist once I got stung, and as Tom explained when I screamed there were like 10 wasps that came out of the sewer. If I would have just stood there, I would have probably been stung repeatedly since wasps have the ability to sting you over and over again. The moral of the story is, nag your husbands ladies, one day it just may save your life!

RIP Bobby Murcer

2008-07-13T08:54:00.002-04:00

Proof!!!

2008-07-06T09:58:00.004-04:00

This picture is really of Arod on the on deck circle but when I was uploading the pictures I decided to zoom in on Jeter who's sitting on the bench. He's looking right at me! See for yourselves damn it!

Enter Sandman

2008-07-06T09:52:00.003-04:00

Mariano Rivera coming in from the bullpen in the 9th. Once again, me screaming telling Tom I've got the chills!!! And yes, by now I'm feeling no pain thanks to the beers!!!!!!

He gets a hit for me!

2008-07-06T09:48:00.005-04:00

Yes, that is me you hear SCREAMING. And yes that's also me that turned the camera on myself and declared my love for him. Tom said it was like watching the Blair Witch Project again.

My last visit to the house that Ruth built

2008-07-06T08:10:00.020-04:00

The morning after.. my voice barely audible, my throat scratchy, my head throbbing but the memories of yesterday will last me a lifetime! First of all, I will never again have the chance to sit in the seats I sat in yesterday at Yankee stadium so I enjoyed every single second of it. 5 rows off the field between home plate and Boston's dug out, clear visible view into the Yankee dug out. Seats that Yankee fans would give their first born for so the rain couldn't even get me down.

So we're driving to the stadium and it's pouring. All I'm thinking is dear God this can not be happening. I keep trying to psych myself (and Tom) up, "its better that its raining now so it gets out of the way", yet all I'm screaming in my head is NOOOOOOOO. Tom agrees (probably to make me feel better). We get over the Tappan Zee and at the highest point of the bridge, could it actually be?? The sky looks lighter, even like the sun may come out!!! I say to Tom, "we're good, we're gonna be ok!" Well that lasted for about 15 mins --the closer we get to Yankee stadium, the harder it starts raining. We find a parking lot and I swear the second I get out of the car it starts coming down the hardest it's been. We walk down the block to the stadium (through puddles and all) and get on line to get into the stadium. Of course it's coming down harder now and there's people waiting on line with us saying, "this game is never gonna happen today," once again the voices in my head continue to scream, NOOOOOOOOO!!! We get inside and I decide I need a beer and a hot dog to get the true feel of being at the stadium before they call this game. This is good, we'll kill some time waiting in line and then we'll check out the weather situation. 15 mins and $28 later (2 beers and 2 hot dogs) it's still raining. "OK. Let's walk around the inside of the stadium for a little bit longer and then we'll just go to our seats," I say. We walk, and walk. It's getting hotter inside and I'm attempting to balance my beer, hot dog, umbrella and purse without knocking into anyone.. all the while checking outside as we get to each opening that looks on to the field. Finally here we are at our section. My fingers are crossed, please God let it have stopped. I close my eyes and hold my breath and look. Are my eyes deceiving me?? Have my prayers been answered?? HOLY SHIT, IT STOPPED RAINING!?? OK OK not completely stopped but we're down to a very light sprinkle. Oh my God this game may happen after all! We sit down, my umbrella goes up and we wait... and wait. It's 3:00 and the game is scheduled for a start time of 3:55. At around 3:15 I put my hand out and feel, oh my God the rain has stopped!!!!!!!! My umbrella comes down and I practically take off my top and run around the stadium in joy. 3:25, here come the grounds crew and there they go, they're taking the tarp off! The fans erupt and scream, "LET'S PLAY BALL!!"

It's now 3:30... and the angels begin to sing because there he is in the dug out walking up the stairs of the dug out on to the field to warm up -- ladies and gentleman I give you DEREK JETER. I have to be careful not to piss Tom off too much now, but my God I can't stop staring. Of course I hear alot of "ok Jeannie, grow up", "that's enough Jeannie", etc etc.. but come on, TK, this man is my destiny, we're soul mates. You can't come between us no matter how hard you try!

This young guy and his wife come and sit right next to us. I swear, he looked like a kid in a candy store. He had this HUGE grin on his face and kept saying, "are you serious?? These are my seats??" "Oh my God honey look the grass is RIGHT there!!" He apologized for being enthusiastic and explained that he was a huge Yankee fan and lived in Florida and would NEVER sit in seats like these again. It was so nice to see such enthusiasm from someone that really appreciated being so close to the action. The game starts right on time and we're under way.

My man gets up and grounds out in the first but it's ok, he's nervous because I'm there and TK is probably giving him the look of death so I understand the ground out. Bottom of the 2nd Giambi gets up to bat and I WISH Tom was recording at that time bc I was SCREAMING "come on Dirk Diggler!!!!!!" As you all know, Giambi had started growing a mustache and has been on a hitting streak ever since so he refuses to shave it. The result - he looks like a 70s porn star now, which is why I call him Dirk Diggler from Boogie Nights. Anyway, I had all the fans around me HYSTERICAL with my Dirk Diggler cheer. Giambi walks and is on first. Robbie Cano singles and Giambi is now on 2nd. Melky gets up and singles to right and holy shit, here comes Giambi rounding third!!!!!! The play at the plate, he's safe!!!! This is where I make my first television appearance of the day. We taped the game and went back and watched it last night. When Giambi gets up and starts walking over to the dug out, you see me with my hands up in the air screaming like a lunatic.

Things are pretty quiet up until the 6th despite the 7, yes 7 batters that are hit through out the game. I still can't believe there wasn't a brawl! Which I must admit, I secretly wished for. I told the guy next to me if there was a brawl I'd be involved in the brawl myself. Him being the excited first time Yankee stadium attendee told me he'd be right behind me -- yay, I have an accomplice!

There was about a half hour span where Tom was gone for some hot dogs and beers and left me alone. I surveyed the situation.. I've got Jeter on the on deck circle, no more than 50 feet away. I can casually walk down the 5 steps to get me to the first row, remove my flip flips and jump the 2 feet tall "wall" there. I'd get to Jeter for sure before the cops tackled me. What would I say? Would he laugh? Would he try to prevent the cops from tackling me? Wait a second, I don't have a pen in my purse, how am I gonna give him my phone #??? Do I just scream it out to him as I brace myself for the blow of a 200 lb man tackling me? Do I run with a camera and try and get a picture of us together? No, that wont work. All the cops will see is me running onto the field with something black in my hands. They'll think it's a gun and shoot me dead for sure. At this point I don't even see the cops around and here I am faced with the decision of a lifetime. A mere 50 feet comes between me and this man that will probably think I'm some whacko if I decide to make a run for it. I'll leave him wondering as he swings his bat watching me think, "who is that mysterious blonde in the white hat?"

Tom Kraus finally returns and explains that he experienced a little situation of his own. As he stood online waiting for a beer and hot dogs, the police were busy tackling ANOTHER woman (so, THAT'S where they were!!). A rowdy drunk BAREFOOT Boston fan was being restrained on the floor. All the while I'm thinking my God that could have been me, thank God I came to my senses!!

We scored another run in the bottom of the 6th thanks to the rookie Gardner who sac flied to right and had Betemit score.

On to the 7th, where I make my 2nd tv appearance of the day. Now I don't remember much about the 7th especially bc when I went back and watched the game last night, a relief pitcher came in for the Yankees and I do NOT remember it happening what so ever! Could have been the beers, could have also been the event that scared the shit out of me. I was either looking in the dug out or on the field for Jeter, not sure which it was but I wasn't paying attention. All of a sudden Tom SCREAMS "Watch out!!!!!!!!" I'm like what the hell is going on? I look all around me and everyone is looking straight up in the air!! OMG it's a foul ball and it's headed this way! I look up and it seemed like it was hanging above my head for about 15 seconds or so, I proceed to cover my head like a gang of thugs are targeting me in a drive by, and crouch down as low as I can. I'm hearing the words "Stop. Drop. Roll." The things they taught us in school if there was ever a fire. My God, why hasn't this fn ball dropped yet??!? I'm still crouching tiger hidden dragon covering my head as I'm sliding back and forth which I'm sure will be coming to a dance club around you soon!! FINALLY the ball drops, 3 rows in front of me and I breathe a sigh of relief. The last thing I wanted was to be carried out of Yankee stadium on a stretcher.. Oh wait, that could have been my moment!!! DAMN!! Destiny so close once again.

Farnsworth comes in at the top of the 8th and I'm thinking, "My God this is where it goes down the drain," but to my surprise, he pitches like an ace! By now, I am drunk and practically celebrating our win already. "BRING IN MO'!!!!!!!!!!!!" I scream as we go into the bottom of the 8th. We go out 1, 2, 3 in the bottom of the 8th and I rise to my feet watching the bull pen. I hear the first 3 bars of ENTER SANDMAN (the one and only Mariano Rivera's theme song) and start screaming like I just won a million dollars (please see video).

This is where it gets scary. And I mean so scary that I thought I was having a heart attack. JD Drew comes up and singles. Ok, we're ok, it's just a single, no outs. We'll be fine. Ramirez comes up and Rivera hits him (3rd time of the game that Manny was hit!) Oh my God, the ump is gonna toss Rivera is all I'm thinking. No warning, nothing!! What is happening here? The man has 22 saves this year and it's 1st and 2nd with no outs???? Moss comes in to pinch run for Ramirez. Lowell comes up and singles, here comes Moss to score. Oh dear God almighty this is NOT happening. Still NO OUTS. Youkilis comes up and Rivera HITS HIM!!!!!!! Bases are loaded, still NO OUTS. Now, I am standing up with my hands on my head. I am thinking this is going to be the worst $500 I have ever lost in my entire life. I look around and I'm not the only one with my hands on my head. People have their face in their hands, I swear I may have even seen some men with tears in their eyes. CoCo Crisp comes up (who I like to refer to as Fruit Loops, Frankenberry and Count Chocula) and strikes out. Ok, ok that's the Rivera I love, come on you can do it!! There's 1 out and the bases are still loaded. Varitek comes up and pops up. Oh my GOD we may win this after all. Now, I AM SCREAMING on the top of my lungs. I look around me and not all of my fellow Yankee fans are standing with me!! Are they nuts???!! "GET THE FUCK UP!!!!!!!!" I scream and motion for them to get up. THEY DO! We are all standing, screaming for Mo and clapping. Lugo is up. Ball 1. Second pitch he swings right through it, strike 1. Third pitch fastball he looks at, called strike. Now, I am practically standing on my seat screaming like it's the World Series and we're about to win. 4th pitch called a ball. This is where I take a moment and look around me. I will never in my life experience this again, this will be a frozen moment in time for the rest of my life and I will never forget it. 5th pitch he swings right through it, it's a strike. OH MY GOD WE WON!!!!!!!!!!!!!!!!!! The place erupts in thunder, I am jumping up and down high fiving Tom. Tom is hugging the Florida guy we met a few hours ago, the place is INSANE!!!!!!!!!!!! I take one more minute to look at the field. Wouldn't you know it, the sun is shining. I like to think that was you Babe throwing in some rays of sunshine right as we won the game. So this is it. I say "Good bye Yankee stadium".

You're the place I visited when I was 7 years old where I can remember the fans running on the field when we won the play offs (when it was LEGAL to do that). Good bye to the place where in 1995 I watched a young rookie named Derek Jeter start his career. Good bye to the place where I've watched endless old footage of Babe Ruth, Lou Gehrig, Roger Maris, Joe DiMaggio, Mickey Mantle, Reggie Jackson, Ron Guidry, Bucky Dent , and Don Mattingly play. Good bye to the place where I listened to The Scooter talk about cannolis and his bride (and sometimes about the game, ha ha ha). Good bye to the place where David Wells and David Cone threw their perfect games that I watched on tv. Good bye to the place where the President of the United States threw out the first ball after the terrorist attacks of September 11th.

Good bye to you my Yankee Stadium, I will never forget you.

Now on to the new stadium in 2009!

Dance Party USA

2008-07-04T10:01:00.003-04:00

OMG, I was such a DANCE PARTY USA fanatic back in the late 80's early 90's!! Check out the outfits and the HAIR!!!!!!! You see, I wasn't the only one with hair that big! I had no idea polka dots were so popular back then but as you can see in the video, they were. And can you say Cavaricci's?? There's some girl wearing the same exact pair I owned, the light blue ones with the flap in the front.

Now how can I leave out the dance moves. I think I mastered them all back in the day at Let's Dance. Oh yes, it's true!

I had a dream......

2008-07-04T07:48:00.003-04:00

I've just awoken from a dream... a strange dream at that.

I was on the Titanic and met Johnny Depp. Now when I say Johnny Depp I mean the 21 Jump Street/ Donnie Brasco / MTV awards in June Johnny Depp. Not the Secret Window / Pirates of the Caribbean Johnny Depp. Anyway, we met and I was trying to get him in the sack-- I know I know, usually when I'm trying to get someone in the sack in my dreams it's Derek Jeter. I'm thinking it may have been from Tom's comment on Wednesday at lunch in the city. He said that our waiter looked like a cross between Johnny Depp / Skeet Ulrich (of course he didn't know his name, he said "the killer from Scream,").

So, I'm trying to get JD in the sack and he's playing hard to get with me. So I'm getting a bit annoyed here. I'm 35 and I have no time for the games Johnny and after all, this is just a damn dream, can you just work with me here!?? So finally, he gives in and kisses me by the pool/kitchen area at like 2 am in the dark. I know, pool/kitchen area? Don't ask.

He kisses me and all of a sudden, I'm in Yonkers whisked away from JD (I guess I survived the Titanic's sinking) and I'm like I have to get to work I have to get work, I forgot to give this to Liz (my boss). Then I woke up.....

Anyone want to try and analyze that doozy of a dream?

Baby boy in little dress (singing like Fat Boy in little coat in Tommy Boy)

2008-07-03T14:24:00.002-04:00

Bridesmaids dresses

2008-07-03T14:23:00.003-04:00

Here's the dresses we'll be wearing on the beach at Rachel's wedding.

The Phantom of the Opera

2008-07-03T14:08:00.004-04:00

We went to see Phantom of the Opera yesterday (a late anniversary celebration). I really liked it alot, at first I couldn't understand how it was the longest running Broadway play of all time but the more I listen to the songs, the more I understand how it's so popular.

I'm not sure how but when I looked around the audience at the end it seemed like no one else was crying except me!! Was I just surrounded by heartless people? I mean this poor man has been in misery all of his life, he finds this woman that actually loves him and he makes her leave bc is such a tortured soul. Come on people, how is that not sad???

My favorite songs:
- The Music of the night

- All I ask of you

- Think of me

- Wishing you were somehow here again (made me think of my Grandpa :-(

I loved the "Masquerade" scene. The costumes were awesome!!

One of the worst movies I've seen in a LONG time!

2008-07-01T10:39:00.006-04:00

Oh, M. Night Shyamalan.. what's happened to you buddy? You had such potential after your directing debut with The Sixth Sense. Now, it's just been one bomb after the other. Never did I think you could make a worse movie than Lady in the Water but you proved me wrong!

DO NOT, I repeat DO NOT go and see The Happening, no matter how much they try and fool you with the trailer the way they fooled me!!

Plot = ZERO, Acting = a joke. And who is this Zooey Deschanel that had a lead alongside Mark Wahlberg?? She was the worst actress I have ever seen!!!!!!! I could have done a better job!!

The Happening = half a star out of 5 stars

Day 3....

2008-06-30T16:27:00.003-04:00

Just an update for those of you that don't know, TK and I quit smoking on Saturday and haven't killed each other yet!!!!!!! Your prayers are greatly appreciated bc the smallest things are beginning to agitate me!

Jude Zheng Lin Milazzo!

2008-06-30T14:34:00.004-04:00

Here's my new nephew Jude Zheng Lin Milazzo who will be joining Chris and Lisa's family shortly. I can't wait to meet him and love him up!!!

Look at that smile! I'm in love already!

Damn you Jackie Warner!!!!!!!!

2008-06-30T09:03:00.002-04:00

I love the show Work Out on Bravo and wish I could afford Jackie Warner as my personal trainer but being that it's not very realistic (at $400 an hour and she's in CA) I try the next best thing. I buy her exercise dvd thinking "this will be a piece of cake, I'm in shape, I work out a few times a week".

OHHHHHHHHHHHHHH THE HUMANITY!!!!!!!! It's 2 days later and I STILL can't walk! I'm sure it's amusing for those watching me walk up stairs, get in and out of my car, and even something as simple as sitting down in a chair. I know what they're thinking, they're probably saying to themselves "look at this one, she must have had a night of hot raunchy sex all night".. I'll let them believe what they want-- after all, their mistaken perception sounds a hell of alot better than the truth!

Add another wedding to the 2009 list!

2008-06-26T11:40:00.004-04:00

Nancy has finally set a date!!! June 26, 2009.

So we're up to 3 so far for next year:
* Nancy and Dave, June 26, 2009

* Jessica and Adrian, September 5, 2009

* Rachel and Joey, October 17, 2009

If anyone's interested I'll be selling my body on the streets of Newburgh to pay for the above.

Anyone wanna pimp me out??!!?? lol

The count down begins, Rachel's wedding in the Bahamas, Oct. 17, 2009

2008-06-25T09:31:00.003-04:00

Rachel is in full wedding mode already (dear God help us all!!!). You'll see lots of blogging about it.

Here's the all inclusive hotel we're staying at, The Riu Paradise:

http://www.riu.com/paradiseisland/

Here's where the reception is taking place, Lucianos of Chicago in Nassau:

http://www.lucianosnassau.com/

OMG!!! She sent WHO home?????????

2008-06-24T11:30:00.006-04:00

The Bachelorette, Season 4. Last night's episode had us down to the final 4 and it was time for the hometown dates. My favorite episodes are when they visit the families (especially for the crazy people when we see the apple doesn't fall far from the tree).

So here we are at the rose ceremony with the final 4. Jessie walks in dressed like Crockett from Miami Vice, followed by Graham looking delish as ever!!!!!!!! Deanna hands out her first rose to Jessie (WHAT?!!) and her second to Jeremy (aka Robotic man). So here we are down to Graham and Jason my 2 favorites. My palms are sweaty and I keep saying, Oh my God I can not believe this!!!!! She calls Jason for the last rose and I'm crushed (selfishly of me bc I wont get to see this fine specimen of a man anymore).

Watch the clip and see what happened after the final rose was given out. She's second guessing her decision now!!!!!!!!

http://youtube.com/watch?v=dJTb65w6Vsw

My Summer Read.....

2008-06-22T09:25:00.003-04:00

Chasing Harry Winston by Lauren Weisberger

Publishers Weekly
The Devil Wears Prada author Weisberger delivers a hilarious, silly and entirely predictable chick lit romp. Book editor Leigh, chef Emmy and wealthy Adriana make a pact to change their disappointing lives within a year. Emmy vows to find the father of her future babies, and Latin temptress Adriana decides to settle on just one of her rich suitors. But Leigh is uncertain about what changes to make; she's lived in the shadow of her legendary literary father and accomplished boyfriend so long, Leigh barely recognizes what makes her happy. The protective wrapping dissolves when she gets the nod to edit bestselling, married author Jesse Chapman-and ends up polishing more than his prose. Emmy-after a year of trying to bed a man from every continent-might discover Mr. Right when he's least expected. As for the relentlessly slothful Adriana, she deflects engagement, but manages to snag something more important. Bookish Leigh defends chick lit as having "sensible structure and coherent language" in a package that's "witty, clever and fun to read." Weisberger is, of course, also talking about this book, and her assessment is right-on.

I have an addiction...

2008-06-22T08:03:00.003-04:00

I am addicted to Barnes & Noble. Don't laugh, it's a serious problem! And to make matters worse, since B&N went online, the addiction only intensified. Just the other day I ordered 6 books online ($25 for 6 books because I'm a bargain shopper) and just yesterday I went to the store and bought another 3!!

The shrink I was seeing last year gave me a reason which I don't find to be valid so if anyone has an idea of what this obsession is about, please share.

Oh no she didn't!!!!!!!!!!!!

2008-06-20T13:53:00.007-04:00

Well now here's a look way back in time (thanks to Jeannine for digging up this doozy of a picture and posting it on Facebook for the world to see!!). This was the weekend we went to Bryant College in Rhode Island (1992? Jeannine correct me if I'm wrong) to visit Jeannine's sister Suzanne (at the far right of the picture).

First let's take a look at the picture, shall we? Let's start with myself, I have naturally curly hair but just to make sure it's curly enough I have a perm on top of it! And how can you miss the 1 inch bangs. Oh yes, me the trendsetter. Let's follow by the CHAMPION sweatshirt with the hunter green jeans to match. A girl's gotta coordinate her colors! Moving right along to Rachel, either the look on my face is a) from too many Zimas or b) PAIN bc Rachel's hair is stabbing my face (notice how my cheek is crushing it) Whoever the girl is with the white scrunchie in her hair I feel for you sister, you maybe getting it worse as Rachel's dagger claws are ripping your flesh!! Moving right along to Jeannine, is that a plaid button up shirt with the arms torn off sister?? LMAO I can barely contain my laughter as I'm typing this now. Yes, we really thought we looked GOOD at the time!!!

Note to my friends out there, please BURN any pictures you have of us from the 90s!!!!!!!!!!

Thank God it's Friday, I'm ready for the weekend!!!!!!!

2008-06-20T09:53:00.003-04:00

How sad that it's 10 am and I can't stop thinking of the delicious dinner I'll be sinking my teeth into tonight (and no, I don't mean Tom Kraus, grrrr).... We're trying out a new restaurant called Stephano's in Wappingers after hearing great things about it (see blog from the Poughkeepsie Journal below.) We'll then be heading to the movies to see "The Happening" the new movie from the director of "The Sixth Sense". I've heard mixed reviews about it but want to see for myself. I was almost inclined to go see "The Love Guru" instead after I saw the preview last night and realized that Justin Timberlake is in it as Jacque LeCock (LMAO!!!!!) Maybe we'll check it out next weekend. Enjoy your weekend everyone!

Stephano’s Ristorante makes Italian-American classics sing
By Daniel Mochon • For the Poughkeepsie Journal •

On weekends, the small gravel parking lot in front of Stephano’s Ristorante can barely accommodate the dozens of vehicles that converge on this Wappingers Falls favorite. The modest place fills up quickly, creating a rubbernecking bottleneck of would-be diners speculating on the next available table as they stand in the foyer.Ambience is clearly not the draw here. The brick-and-stucco facade looks like it was stuck onto the side of a private residence and is a little worn around the edges. Inside, the stark white theme continues, with just a few small paintings of Florence and other Italian cityscapes to liven up the achromatic space.It can get a bit noisy, with scads of private conversations and a bustling kitchen to compete with. The loud Sinatra-esque tunes didn’t help, either, adding another brash layer of sound into the mix — no offense to Ol’ Blue Eyes, of course.We were greeted somewhat brusquely by one of the hosts, and quickly seated at one of the few vacant tables.

As we perused our menus, warm rolls arrived, accompanied by garlic-chive butter, marinated red pepper strips and some very tasty black olives.Among the 10 bottled beers available, I opted for a bottle of Peroni’s Nastro Azzuro ($4.50), which means ‘‘blue ribbon.’’ Perhaps this is Italy’s version of Pabst; the ultra-pale golden lager was a bit sweet and more refreshing than complex.Three jumbo white shrimp were marinated in balsamic vinegar and tightly wrapped in a shroud of air-cured ham for the Gamberi al Proscuitto ($8). The dapper prawns rested atop a hummock of roasted red peppers drenched with a basil-infused olive oil. I liked this combination of salty proscuitto and crisp, sweet shrimp meat, which was further enlivened by a judicious dredging in the tasty oil.Mozzarella Fresca alla Caprese ($8) had linear rows of sliced roma tomatoes, fresh mozzarella and shaved proscuitto di Parma. The goodies were drizzled with a garlicky olive oil vinaigrette and finished with julienned basil. The star of this plate was the cheese — the mozzarella rounds were creamy, nicely salted and tender. After a day or two, mozzarella starts becoming rubbery; this was obviously freshly made.

Ravioli right on the moneyChef Steven Justry’s housemade Cheese Ravioli ($14) were so uniform and well-constructed, they were indistinguishable from commercial versions. An ample portion of the herbed ricotta pillows was topped with a tangy marinara and some grated romano cheese. Texturally, the ravioli were right on the money — soft, but not mushy. My companion, who is of Italian-American descent, was slightly disappointed overall, but then again, he was using his nonna’s ravioli as his gold standard.Saltimbocca ($19) is roughly translated as ‘‘jump in the mouth.’’ There are countless interpretations of this Roman dish; Stephano’s version had pan-fried scaloppini of veal topped with proscuitto and melted fresh mozzarella. It was served on a bed of very well-cooked spinach and surrounded by a slightly sweet brown demi-glace sauce seasoned with fresh sage. Though it was good, my portion was large enough that I decided half of it would have to jump into a doggy bag.Entrees include a house salad and a side of pasta. As is my tendency, I added crumbled gorgonzola ($1.50 extra) to my salad, which was comprised of chopped green leaf lettuce, tomatoes and red onions with a sweet-tart balsamic and wine vinegar dressing. My saltimbocca was served with a bowl of soft linguine topped with a chunky tomato sauce.

The 29 wines are simply delineated on a single page, though vintages are provided. Bottle pricing runs between $21 and $48. The majority of the selections are recognizable brands and types, most are from California, Australia and Italy. Glass pours are not listed, and after inquiring, were recited by our hostess by varietal (i.e., Merlot) without any other information.Our bottle of Batasiolo Dolcetto d’Alba ($24) was fairly earthy and fruit-driven. Typical of the hot conditions of the 2003 vintage, this wine had a lot of ripeness and was relatively low in acidity. It was only a fair match with the ravioli, but went pretty well with the off-dry demi-glace that came with my saltimbocca.

Many desserts made herePrices are not provided on the sheet of paper that lists the dessert offerings. Four of the five dolci are made on the premises. Among the three types of cheesecake, my companion thoroughly enjoyed his wedge of Apple ($7). A classic graham crust was the foundation for a tangy cream cheese filling that was topped with a cinnamon-y layer of tender baked apples.Tartufo ($7) is purchased from a vendor, and was a chocolate covered globe of ice cream cut in half and hinged outward on the plate. The tartufo had pieces of maraschino cherry and hazelnut inside. Though nothing was wrong with this dessert, I wasn’t especially moved by it.Served with a bottle of sambuca for those who like a shot of anise liqueur in their coffee, Espresso ($3) was hot, strong and complete with a thin twist of lemon.Our service, though comprehensive, was somewhat perfunctory and lacked warmth. Three different people took care of our table at various stages, and the friendliest was the busboy who delivered our entrees. However, with the exception of our entrees, everything arrived quickly and efficiently.Since September of 2000, the wife and husband team of Heather Cristantiello and chef Justry have been dishing up success at Stephano’s with generous portions of decent, well-executed Italian-American classics.

CSI for Wii

2008-06-13T13:35:00.003-04:00

So, I've always wanted to be a forensics specialist but bc of my weak stomach and lack of desire to go to school, let's just say I never went in that direction. So what's the next best thing? CSI for Wii!!! I spent 3 1/2 hours last night figuring out who torched the white supremacist gay bashing taxi cab driver and I must confess, had a bit of an adrenaline rush every time I found a new piece of evidence! The used condom was a tad too much and poor Tom Kraus had to practically run to the bathroom and to wash his hands when I had to virtually swab the inside of the condom for DNA. LMAO..

Well back to work I go. I can't wait to go home and solve the 2nd case!!!!!!

Wow, it's been awhile...

2008-06-12T15:18:00.004-04:00

Hello hello hello to everyone out there in cyber land.

I have returned due to the wishes of my "Lawng Island" best friend. I went MONTHS without a blog from her but bc she just can't get enough of me, I've returned to brighten her days with the small and boring details of my life.

Well here we are, it's almost Summer. The sun is shining as we speak and here I sit in hell writing my 6 month performance review. Why, WHY must I have to do this!?? Shouldn't my performance speak for itself?? Now why do I have to go back and write everything I've done over the past 6 months? I swear they do this just to push people out the door because if you're teetering on leaving the company, this time of year will definitely push you over the edge! How about I say, "yes I busted by ass, no I do not get enough money, yes I know what I say won't matter bc you already have your budget mapped out in that corporate America head of yours!"

Well that's enough about me for now. I have to space any exciting details of my life over at least 6 blogs because God knows there isn't much!!

Peace bitches!
xoxooxxoxo

Favorite Christmas movies of all time

2007-11-20T14:13:00.000-05:00

I know it's not even Thanksgiving but I'm in the holiday spirit! My top 5 favorite Christmas movies of all time:

#1 National Lampoon's Christmas Vacation
#2 A Christmas Carol (the 1984 version with George C. Scott)
#3 Home Alone
#4 Miracle on 34th St. (the original)
#5 Elf

#6 Sorry I had to choose 6, It's a wonderful Life

Whats yours??

Black Friday 2007

2007-11-20T14:10:00.001-05:00

Thanks Janet for this link that lists specials for this Black Friday:
http://bfads.net/

I will think of all you crazy shoppers on Friday as I am warm in my house playing Christmas music, drinking tea, and putting up my Christmas tree. :-)

Today, I'm grateful for the things I have in my life...

2007-11-19T09:05:00.001-05:00

Perhaps in my old age I'm finally beginning to mature a bit. As I drove into work today on this Monday of Thanksgiving week, I was thankful first of all that the traffic was light. It then got me thinking all the things I am thankful for.

I am thankful for my health.
I am thankful for all the wonderful people I have in my life that are supportive of me and love me even for my faults.
I am thankful that all my loved ones are healthy.
As much as I complain about it, I am thankful for my job, :)
I am thankful for my home and that I am able to live comfortably.
I am thankful for my dogs and that they are healthy.
I'm thankful that I have so many wonderful memories that I am able to look back on and smile.
I am thankful for all the memories that I will continue to make in the future....

First Thanksgiving without my gramps : (

2007-11-14T13:00:00.000-05:00

This year will be our first Thanksgiving without my grandfather. Even though I didnt get to spend Thanksgivings with him since he was in Florida, I still spoke to him on the phone every year on Thanksgiving day. I still remember our conversation last Thanksgiving. He was so happy when my grandma told him I was on the phone, he said "is that my neenie?" (what he used to call me). He proceeded to tell me how it was too hot in Florida (as he always did lol) and how he would take a nap after his turkey.

I miss him every day : ( You realize when someone/something is around you take it for granted, and then when they're gone you realize how much you miss them. I thought he'd always be around, never did I imagine he wouldn't.

Anyway, I know he's watching down on me though keeping me safe and loving me from above.
I love you Grandpa...xoxoxoox

Damn you Broadway stagehands

2007-11-12T14:48:00.000-05:00

After a morning of confusion and anxiety during which members of Local One, the stagehands union, met and the producers waited to see what would happen, the stagehands strike has officially begun. Union members are holding picket signs in front of theaters and the International Alliance of Theatrical Stage Employees, the parent union of Local One, issued a statement confirming the walkout.

The stagehands took their picket signs to the wet sidewalks around 10 a.m. today, after a meeting of Local One, their union, at the Westin New York on West 43rd Street.
The Saturday matinee traffic of tourists and theatergoers was thrown into chaos, with busloads of students sitting unhappily outside of “The Color Purple,” and nervous restaurant workers contemplating a Saturday night with no dinner rush.
“Customers may show up but they will be grumpy and won’t tip well,” said Laura Cosentino, as she stood on West 46th Street handing out menus for Rachel’s, a theater district restaurant.
Twenty-seven Broadway shows, including “Wicked,” “Jersey Boys” and “The Lion King” were shuttered, starting with “Dr. Seuss’ How the Grinch Stole Christmas! The Musical” which was to raise its curtain at 11 a.m.
Only eight shows, which are in theaters on a separate contract with the union, are still running: “Cymbeline,” “Mary Poppins,” “Mauritius,” “Pygmalion,” “The Ritz,” “The 25th Annual Putnam County Spelling Bee,” “Xanadu” and “Young Frankenstein.”
Mayor Michael R. Bloomberg released a statement saying: “I had hoped that the theater owners and the stagehands’ union would resolve their differences without a strike. While this is a private labor matter, the economic impact is very public and will be felt far beyond the theaters closed today. It is in everyone’s interest for both sides to come together and resolve their differences. I have spoken to both the theater owners and the stagehands and the city continues to stand ready to help in any way we can.”
This is the second strike on Broadway in less than five years; the four-day musician walkout in 2003 was the first in almost three decades. But this is the first time Local One, a 121-year old union, has called a strike on Broadway.
Producers have made plans to give refunds to people who have bought tickets to shows that would be canceled. The first show to be shuttered by the walkout is “Dr. Seuss’ How the Grinch Stole Christmas! The Musical,” which begins performances at 11 a.m.
On Thursday, after two long days of negotiating with the League of American Theaters and Producers, the stagehands’ union was given the authority to strike by its parent union, the last step necessary before a strike can be called.
A session scheduled for Friday did not take place, and all around Broadway, producers, stagehands and just about everyone else in the industry were buzzing with theories about when or if the stagehands would walk out.
Local One officials had been expected to give a few days’ notice before a strike was called, though a note on the union’s Web site said that the parent union, the International Alliance of Theatrical Stage Employees, would advise Local One as to when the strike would begin.
The talks, which have been going on since before the union’s contract expired in July, broke down over the issue of work rules.
The contract with Local One has strict rules governing how many stagehands must be called to work, what kind of tasks they can perform and how long the work calls can be scheduled. League members say the rules inevitably lead to long periods of time when stagehands are on the clock with nothing to do.
The league has been pushing for more flexibility in deciding how many stagehands are needed for work and when they are needed, and they have offered a package of raises in return for that flexibility.
James J. Claffey, the president of the union, has said that the stagehands would be willing to make changes to the rules in return for benefits of equal value. But there is no way to tell how much work the stagehands would lose under the rules the producers are proposing, Mr. Claffey said, and so it would be difficult to gauge the value of what the league has been offering in return.
It is unclear how long a strike would last. League members have privately speculated that the pressure to get Broadway up and running again would keep the strike from going longer than three or four days. Union officials say that a strike could go for weeks if necessary; Mr. Claffey has already turned down an offer from Mayor Michael R. Bloomberg to help in the negotiations.
By taking a few cents out of every ticket over the past few years, the producers have amassed a $20 million fund to help weather a shutdown by covering fixed costs, like insurance. But for shows that do not have much in the way of advance sales — sales that could be refunded — a strike that went on for more than a few days could be fatal.
Local One, which has around 2,200 members, roughly a quarter of whom work on Broadway, has accumulated its own $4.1 million emergency stockpile. The union has set aside an additional $1 million to help members of the other unions that will be out of work during a strike.
Union officials also point out that there are more than a thousand non-Broadway jobs in Local One that stagehands can rotate into while they are not working on Broadway, but that rotation system has become more complicated now that the strike by the Writers Guild of America has left Local One members in the television industry without work as well.

The holidays

2007-11-12T14:10:00.000-05:00

Well first of all, I can't believe that Thanksgiving is next week already. This year FLEW by!

I was determined to get my Christmas shopping done, and that I have.. I only have a few more gifts left to get, YAYYYY! December will be a busy month. We're going to try and get to the city to see the tree on Dec. 8th and then the 15th is the annual Milazzo/Kraus bake off.

Hope all your preparations for the holidays are going well! :-)

My life these days

2007-10-23T10:06:00.000-04:00

I haven't blogged in a few weeks bc not only is my new job consuming me but I have been sick for the 2 weeks to boot. I can't believe Halloween is in a week and I never even got around to getting Mickey and Annie's Halloween costumes. I'm such a bad mommy! Imagine if I had kids? "Sorry kid, I've been too busy-- now go grab a sheet from the closet and cut some holes in it". Hahahahahaha.

I'm hope you are all doing wonderful.. Adele hope you are enjoying Bobelia being there and Lisa should be on her way to St John today!

Love you all- J
xoxoxoooxox

Donate a free mammogram

2007-10-05T13:05:00.000-04:00

Donate a free mammogram just by clicking on the link and clicking on the pink button. There are corporate sponsors who pay for the mammogram...All anyone needs is AWARENESS!!!!

http://www.thebreastcancersite.com/clickToGive/home.faces?siteId=2

Spread the WORD....

Canine Grease Routine?

2007-10-04T15:24:00.001-04:00

Toni-Ann as Super Girl, Halloween 2005

2007-10-04T15:18:00.000-04:00

Mickey as Superman, Halloween 2005

2007-10-04T15:16:00.000-04:00

Today is a better day

2007-10-04T15:09:00.000-04:00

So, yesterday my friend posted a bulletin on Myspace about how her friend found 5 lab puppies in the middle of the road and was currently keeping them in her basement. She called all around to different shelters and could not find a shelter that would take them. She was then planning on calling Animal Control and having them take the pups but if they werent adopted within 5 days they would put them to sleep. I refused to accept this so I started calling around to different shelters and by the grace of God I got a call back today from the Elmsford Animal Shelter (a no kill shelter) that is willing to take them. I feel SO MUCH BETTER now. I was sick about this yesterday. You know, I could get used to doing something like this for a living, I feel like a made a difference in someone's life today.. yes puppies count as "someone". :-)

The TK list goes on

2007-10-03T11:26:00.001-04:00

Added to the TK story list:

"Doing 90 on 84 to catch Nelly"

I'll take a side of you F*CKIN A$$HOLE with those fries

2007-10-03T11:13:00.001-04:00

Last week I was driving alone and busted out in hysterics remembering one of my favorite stories of all time. It's not exactly a Tom Kraus story but he was there along with Jeannine.

Me, Jeannine, and Tom drove to Pennsylvania when Jeannine had first separated from the fat pig to get a car from her uncle (the fat pig took her car away from her). So on the journey there I became hungry and wanted to stop at Wendys for a quick bite to eat. Well, on this particular day I was fighting with TK, this could of been during the days of shooting myself with hormones, I'm not sure. Anyway, as we are waiting in line at the drive thru on a beautiful afternoon with all of the windows open, I became very pissed off at Tom and SCREAMED "YOU FUCKING ASSHOLE!" The car that was in front of us that had just driven off proceeded to back up to the window and said to the innocent Wendy's employee, "What did you call me bitch?" Yes, the man thought the Wendys drive thru person called him a fucking asshole. This then followed with the apologetic manager explaining to the man that his employee would never do such a thing!!

No, I never fessed up to it, yes the employee probably got fired, and yes, I am going to hell.

Freestyle Fever, November 21, 2007

2007-10-02T15:10:00.000-04:00

O M G, in the words of the Pointer Sisters, I'm SOOOOOO EXCITED. My ticket is already ordered along with my girls--- it will be a night to remember!!!! Don't worry Lisa, I'll still make it to your house for Thanksgiving (perhaps later than expected though). :-)

The line up:

TKA, K7, Johnny O, Cynthia, Judy Torres, George Lamond, Rob Bass, Nice and Smooth, the Sugar Hill Gang!!!!!

I'm breaking out the pink and white can of Aqua Net for this special occasion. Oh yes, it's ONNNNN!!!!

Let's do it, let's discuss Britney

2007-10-02T13:41:00.001-04:00

In the words of Popeye, "I've had all that I can stand and I can't stands no more". I've held my tongue for as long as I could about her.... what a stupid bitch. For all of you out there that sympathize with her, "awwhhh the poor girl" give me a freakin break. Sure defend her showing her snatch to the world, her late nights out while her kids are home with the nanny, her parading naked in front of her kids while she's high as a kite, dragging the kids out with her at 10:00 at night bc SHE wants to get dinner. Her problem? She's got more $ than she knows what to do with. Can you imagine having such a problem? I can only be so lucky. Hey Britney I have an idea. Let's switch lives, let me have YOUR problems please!!! The judge gives her a chance and what does she do? whatever she pleases! refuses the drug testing, refuse to meet with the drug counselor, never enrolls in the parenting class. All the things she was TOLD by the judge to do. I guess she thought her celebrity status was going to allow her to do what she wants, guess you were wrong bitch!

Once again, a fine example of someone that should not be a parent. It just pisses me off bc there are so many good people out there that would kill for what she has. Anyway, I just needed to vent so thank you all for listening. :-)

Knocked Up

2007-10-02T12:08:00.000-04:00

Ok, so those of you that haven't seen it MUST see it (I'm willing to even lend out my dvd) not just bc it's freakin hilarious but bc the relationship between the 2 sister's significant others defines the relationship between Tom Kraus and Chris Milazzo!!!

Mickey and Annie Halloween 2006

2007-10-02T08:43:00.000-04:00

Option #2 - Superhero puppies

2007-10-01T16:15:00.001-04:00

http://www.costumesinc.com/t771/All-Pet-Costumes.html

Option #1 - The star quarterback and the hot cheerleader

2007-10-01T14:13:00.000-04:00

There has to be a theme every Halloween, for instance last year the theme was their names, Mickey was Mickey Mouse and Annie was Raggedy Ann.

Here is option #1 for this year. At the end of this process I may take a vote. This one was found at: http://www.wiggle-n-waggle.com/

Don't tase me bro!

2007-10-01T14:01:00.000-04:00

I can't believe they have a tee shirt already for the kid that got tased at the John Kerry Forum!

Funny tee shirts

2007-10-01T13:45:00.001-04:00

I'm a sucker for funny tee shirts... I'm getting the Jeter one for sure! All can be found at shirtforbrainz.com

I love the month of October!

2007-10-01T11:41:00.000-04:00

I love the month of October. The leaves on the trees are so pretty, the air is crisp and cool, spooky movies are played all month long anticipating Halloween, kids are deciding on Halloween costumes.. I'll be posting some blogs in the coming weeks about what I'll be for Halloween (if I can find somewhere to go!) and what Mickey and Annie will be this year.

2 more!

2007-10-01T11:24:00.000-04:00

Thanks Jeannine for the 2 I keep forgetting to add to the Tom Kraus list:

- Mariah Carey? I dated her when I lived in Mt Vernon
- Captain Lou Albano delivers Tom Kraus in the back of a cab

We're not in Kansas anymore...

2007-09-30T08:27:00.000-04:00

Thanks to Diana for the pic of this rainbow after a storm we had here on Friday. I personally didn't see it (I was driving home from work through the belly of the beast of a storm) but EVERYONE else saw it.

Mining for ticks?? One of my all time favorite Tom Kraus stories...

2007-09-29T15:37:00.000-04:00

How about the time TK thought he had a tick on his balls, went to the 24 hr clinic, and encountered a dr named Peter Gay. Dr. Gay proceeded to put on a helmet like device with a spotlight in the front. As he went "down on my husband" so to speak, TK said he looked like a coal miner searching for a tick on his balls. "Ahhhhh son, that's not a tick, it's just a blood blister!!!"

That one's just for you Adele, one of my all time favorites. xoxoxoxooxoxo

Surveys relax me

2007-09-28T13:01:00.000-04:00

1. If you were to kill a man, horror movie style, which kitchen utensil would you use?hit him over the head with a meat tenderizer

2. Did you ever swallow a coin?i dont think so

3. What was the worst gift you've ever received?oh there have been QUITE a few.. i will say a candy dish like 2 years ago, so obvious it was from the dollar store

4. What is your most embarrassing childhood memory?i was sledding going down this big hill and went right into this guy, took him out at the knees! LMAO

5. How many kids do you want?1 would be nice

6. Whats your moms middle name?Adele

7. Have you ever operated a fire extinguisher?no thank god

8. Which family member do you look like most?I dont look like anyone.. I would say Diana bc people sometimes tell us we look like sisters

9. who do you hate?I don't hate anyone....I seriously dislike a lot of people! ha ha ha

10. Describe your figure:toning up but not where i want it to be yet

11. do you have any reallllly crazy relatives?do I count?!

12. Did you ever wake up under the influence of NyQuil, completely unable to move?NyQuil has a wierd effect on me, it will knock my ass out for like 2 hrs but then i am up and cant sleep for the rest of the night

13. What is your least sexiest feature:hmmmm i guess my stomach?

14. Did you own a Lite-Brite?I miss that damn thing!

15. Can you dive?i cant even swim, you want me to dive?

16.who was the last person that told you they loved you?tom

18. Have you ever used a pogo stick?every night, grrrrrrrrrrr

19.Do you like children?yes love them...especially when they aren't mine!

20. Whats your favorite Jelly Belly jelly bean flavor?i dont really like jelly beans

21. favorite food you CRAVEEE?i ALWAYS crave steak!

22. What do you like most about yourself?i think i'm funny and silly

23. Given anyone a bath:mickey and annie, oh and my nieces and nephew

24. Last time you took a bath:a long time

25. Date someone older or younger?ive dated both, some more of an age difference than others. ;-)

26. If you were on Double Dare, would you take the physical challenge?I will STILL watch that show to this day

27. What's the largest living organism that you killed?a person, he's buried in my backyard, shhhhhhhh

28. Did you ever take a lighting bug and smear its guts on your arm so you get a cool glowing effect like war paint?ill, no

29. Honestly, what color is your underwear?baby blue

30. if you could be anywhere in the world doing anything right now what would it be?on a beach in Bermuda reading or sleeping

31. Can you juggle?i know how to juggle balls :-)

32. how do you feel right now?tired

33. Do you remember that square candy bar called "Chunky"?holy shit YES, i forgot all about those

34. Do you think that someone is thinking about you right now?maybe

35. What was your favorite toy as a kid?barbies

36. Have you ever changed religions?no, but i question mine alot

37. Did you answer question 17?what was it?

38. Did you go back to look for question 17?ha hahah yeah I did!

The return of Greys

2007-09-28T12:00:00.000-04:00

So, who saw it last night? If you didn't don't read anything below until you have!!

1) Did anyone else cry with the deer scene? I was bawling bc yeah, I'm gay.I'm so glad the deer made it.. I would have done the same thing. Izzy is my new favorite now bc of what she did to save it.

2) Would someone pls shoot Callie? God she's fn annoying..I can't take her anymore.

3) McDreamy isnt looking as hot this season (or is it just me?) .. Now McSteamy on the other hand, GRRRRRRR....

4) I miss Addison and Burke...

5) I almost peed in my pants when McSteamy confessed to McDreamy he came to Seattle to get him back! LMAO

6) Thank God I stayed up to watch it... I looked up at 10:01 pm and my DVR had stopped recording right before George showed up at Izzy's to tell her he loved her. If I would have missed that, I would have been PISSED!

Next week's episode looks awesome, I can't wait!

That's all it until then...

Good and bad day

2007-09-27T15:47:00.001-04:00

So I've cried twice today, first for tears of joy and second for tears of frustration.... No, I am not PMSing... Oh wait, I AM! LOL

The good news:
Jeannine got full custody of Gavin!!!!!!!!!!! Yayyyyyyyyyyy! I can't even express how happy this made me today. Jeannine wanted me to say thanks to everyone for your prayers. She sounded like she was on cloud nine.

The bad news:
I hate my fuckin job... I hate the corporate environment, I hate this place. It's all political bullshit and I'm SICK SICK SICK of it. I am so ready to win the lotto and tell them what to do with this job. Monster.com here I come again!

Capeesh

2007-09-24T16:10:00.000-04:00

" CA PE ES H " Capeeshe Italiano........

Let's start at the beginning.

Come stai? Molto bene. Bon giorno. Ciao. Arrivederci. Every Italian from Italy knows these words and every Italian-American should.

But what about the goomba speech pattern? Those words and phrases that are a little Italian, a little American, and a little slang . Words every Paesano and Bacciagaloop we have heard, - words we hear throughout our Little Italy neighborhood of New York This form of language, the "Goomba-Italiano " has been used for generations. It's not gangster slang terms like "whack" or "vig", if that's what you are thinking---nope, this is real Guido talk!

The goomba says ciao when he arrives or leaves. He says Mama Mia anytime emotion is needed in any given situation. Mannaggia, meengya, oofah, and of course, va fongool can also be used. Capeesh?

He uses a moppeen to wipe his hands in the cuchina, gets agita from the gravy and will shkeevats meatballs unless they are homemade from the famiglia. Always foonah your bread in the pot of gravy (sauce) or you will be considered a real googootz or a Mezzo-finookio.

There are usually plenty of mamaluke s and the girl from the neighborhood with the reputation is a facia-bruta, puttana or a schifosa.

If you are called cattivo, cabbadost, sfatcheem, stupido, or strunz, you are usually a pain in the ass.

A crazy diavlo can give you the malokya (evil eye), but that red horn (contra malokya) will protect you if you use it right.

Don't forget to always say per favore and grazia and prego .
If you are feeling mooshadda or stounad or mezzo-morto, always head to Nonna's and she will fix you up with a little homemade manicott', cavadell', or calamar ', or some ricotta cheesecake.

Mangia some zeppoles, canolis, torrone, struffoli, shfoolyadell', pignoli cookies, or a little nutella on pannetone. Delizioso! I think I will fix myself a sangweech of cabacol' with some proshoot and mozarell' or maybe just a hot slice of peetza .

So salud' if you have any Italian blood in you and you understood anything written here! Then, you are numero uno and a professore of the goombas.

If you don't get any of this, then fa Nabola with the whole thing and you are a disgraziato. Scuzi, Mia dispiachay, I didn't mean that....... Just....... Fugheddaboudit

Jeannieology

2007-09-24T11:25:00.000-04:00

Let others know a little more about yourself, repost this as your name followed by "ology."

MOUTH-OLOGY
Q. What is your salad dressing of choice?
A. Olive oil and balsamic vinegar or Ranch

Q. What is your favorite fast food restaurant?
A. i try to stay away from it but sometimes I want some McDonalds!

Q. What is your favorite sit-down restaurant?
A. Robertos, Gina Maries, Via Nove, Yobo, Cafe Maya

Q. What food could you eat every day for two weeks and not get sick of?
A. french fries

Q. What are your pizza toppings of choice?
A. pepperoni and i like olives and bacon, yummy

Q. What do you like to put on your toast?
A. peanut butter

TECHNOLOGY
Q. What is your wallpaper on your computer?
A. a wedding pic of me and tom kraus

Q. How many televisions are in your house?
A. 2

BIOLOGY
Q. Are you right-handed or left-handed?
A. right

Q. Have you ever had anything removed from your body?
A. yes, a gerbil

Q. What is the last heavy item you lifted?
A. 100 lbs with my legs at the gym yesterday

Q. Have you ever been knocked unconscious?
A. just with anesetha

BULL[CRAP]OLOGY
Q. If it were possible, would you want to know the day you were going to die?
A. honestly, i'm not sure..

Q. If you could change your name, what would you change it to?
A. Ivana Hiscock

Q. What color do you think looks best on you?
A. blue

Q. Have you ever swallowed a non-food item by mistake?
A. LMAO i will leave this one alone

Q. Have you ever saved someone's life?
A. not that im aware of

Q. Has someone ever saved yours?
A. yes.. my brother basically carrying me on his back running from the machete guy

DAREOLOGY
Q. Would you kiss a member of the same sex for $100?
A.. sure, Jessica Alba please

Q. Would you allow one of your little fingers to be cut off for $200,000?
A. no no no

Q. Would you never blog again for $50,000?
A. hmmmm, yeah i think i could do it... wait, now i'm not so sure!

Q. Would you pose naked in a magazine for $250,000?
A. no way

Q. Would you drink an entire bottle of hot sauce for $1,000?
A. shit tom kraus did it for a free breakfast!

Q. Would you, without fear of punishment, take a human life for $1,000,000?
A. Nope, unless its someone that hurt someone i loved, then i could do it for free

DUMBOLOGY
Q: What is in your left pocket?
A. i dont have a left pocket

Q: Is Napoleon Dynamite actually a good movie?
A. i know i'm gonna hear some shit for this but i thought it was one of the stupidest movies i have ever seen

Q: Do you have hardwood or carpet in your house?
A: both

Q: Do you sit or stand in the shower?
A: stand

Q: Could you live with roommates?
A: depends on who, i have lived with quite a few people so I'd say yes

Q: How many pairs of flip flops do you own?
A. i think like 10 or so

Q: Last time you had a run-in with the cops?
A: not in a really really really long time...

Q: What do you want to be when you grow up?
A: a billionare's wife

Q: Who is number 1 on your top 8?
A: Nini

LASTOLOGY
Q: Friend you talked to?
A: The Pants

Q: Last person who called you?
A: Tom Kraus

Q: Person you hugged?
A: Tom Kraus

FAVORITOLOGY
Q: Number?
A: 2

Q: Season?
A: Spring

CURRENTOLOGY
Q: Missing someone?
A: yes

Q: Mood?
A: i'm ok

Q: Listening to?
A: my keyboard as i type

Q: Watching?
A. nothing, i'm at work!

Q: Worrying about?
A. if i get the job i want

RANDOMOLOGY
Q: First place you went this morning?
A: to pee

Q: What can you not wait to do?
A. go home!

Q: What's the last movie you saw?
A: Good Luck Chuck

Q: Do you smile often?
A: all the time

Q: Are you a friendly person?
A: i think so, i talk to anyone

American kids vs. Italian kids

2007-09-24T10:41:00.000-04:00

American Kids: Move out when they're 18 with the full support of their parents.
Italian Kids: Move out when they're 28, having saved for that nice house and are a week away from getting married .... unless there's room in the basement for the newlyweds.

American Kids: When their Mom visits them she brings a nice bundt cake and you sip coffee and chat.
Italian Kids: When their Mom visits them she brings 3 days worth of food and begins to immediately tidy up, dust, do the laundry or rearrange the furniture.

American Kids: Their dads always call before they come over to visit them and its usually only on special occasions.
Italian Kids: Are not at all fazed when their dads come over, unannounced, on a Saturday morning at 8:00 and starts pruning the fruit trees. And if there are no fruit trees, he will plant some!

American Parents: You can leave your kids with them and you always worry if everything is going to be ok plus you have to feed them after you pick them up.
Italian Parents: No problem, leave your kids there and if they get out of line your parents can set them straight .... plus they get fed.

American: Kids: Always pay retail and look in the yellow pages when they need something! done.
Italian Kids: Just call their dad or uncle and ask for another dad's or uncle's phone number to get it done . cash deal, know what I mean?

American Kids: Will come over for cake and coffee and get only cake and coffee, no more.
Italian Kids: Will come over for cake and coffee and get antipasto, a few bottles of wine, a pasta dish, a choice of two meats, salad, bread, potatoes a nice dessert cake, fruit, coffee and a few after dinner drinks .... time permitting there will be a late lunch as well.

American Kids: Think that being Italian is a great thing,
Italian Kids: Know that being Italian is a great thing,

American Kids: Never ask the reason you have no food.
Italian Kids: Are the reason you have no food.

American Kids: Will say 'hello".
Italian Kids: Will give you a big hug and a kiss, pinch your cheeks, and pat you on the back.

American Kids: Call your parents Mr. and Mrs.
Italian Kids: Call your parents Mom and Dad.

American Kids: Have never seen you cry.
Italian Kids: Cry with you.

American Kids: Will eat at your dinner table and leave.
Italian Kids: Will spend hours there, talking, laughing and just being together.

American Kids: Borrow your stuff for a few days then give it back.
Italian Kids: Keep your stuff so long they forget it's yours.

American Kids: Know a few things about you.
Italian Kids: Could write a book with direct quotes from you.

American Kids: Will leave you behind if that's what the crowd is doing.
Italian Kids: Will kick the whole crowds' ass that left you.

American Kids:Would knock on your door.
Italian Kids: Walk right in and say, "I'm home!"

American Kids: Are for a while.
Italian Kids: Are for life.

I'm never drinking again...

2007-09-22T16:59:00.000-04:00

Last night was date night for me and TK. Sushi (spicy crunchy tuna- delish) and a movie ("Good luck Chuck - cute movie, but a little raunchy I thought)..

Anyway, I got a text from "the Pants" (aka Nancy, one of my best friends) that she'd be making a rare appearance out at a bar that one of our friends from high school dj's at. Like I said, since it's rare that Nancy comes out, I had to make the journey out myself after date night. I told Tom I didn't plan on staying long (he was tired) and I'd just have a drink or two. Well, I kicked back the first drink (a STRONG watermelon martini) in less than 15 mins and was well on to my 2nd by the time Nancy got there. If you know me, you know I do not know how to drink in moderation. I don't drink often, so when I do, I drink to get drunk. Well an hour later and 3 drinks in, I was lap dancing Tom Kraus on the dance floor, grabbing various asses and breasts on the dance floor (relax, I know who they belonged to) and by the end of the night I had poor Tom driving me all over for some french fries. Which brings me to my next point... why in the hell wouldnt McDonalds, Burger King, or Wendys be open past 1 am on a Friday night? Don't they know people go out on the weekend and crave junk food??!?? They're losing some serious revenue there. Damn you fast food chains, damn you all.

Of course I was not able to close my eyes once I got home, even though I was exhausted by then. Why is it you feel fine when you're still at the bar drinking, laughing, and carrying on yet the second you walk out the door the reality of how you're going to feel the next day hits you? I prayed to God to please make the room stop spinning long enough for me to pass out -- fyi God doesn't listen to drunk 34 yr old women pleading for his mercy bc it only got worse. I begged Tom for some Triscuits.. My thinking was the wheat would soak up the alcohol and the room would stop spinning -- nope didn't work either. I must have passed out around 2 am or so in the fetal position sitting UP on the bedroom floor with my feet planted firmly on the ground.. woke up around 6 am and was thankful I was now able to lay with my head on the pillow, so I crawled into bed feeling how old I really am and it was lights out as the sun was coming up...

Ahhh, I'm too old for this shit!

A prayer for Jeannine...

2007-09-21T13:40:00.000-04:00

Jeannine has a big court date next week regarding Gavin's custody. Please everyone say a prayer that evil will not prevail. Thanks.

I laughed so hard last night I almost peed in my pants..

2007-09-21T11:20:00.001-04:00

So last night after a relaxing night of shopping and dinner, Tom Kraus and I were laying on the couch together watching "Don't forget the lyrics" (did anyone see it last night, some lady won $350K!!).. Anyway, when we lay on the couch Tom is always sitting up and I always lay down with my feet on his lap. Well it just so happened that Tom and I both tried to get up at the same time which resulted in my toe nails scraping his throat (btw I think there still may be some of his skin under my big toe nail). He screamed in pain, "Jesus! You just had those things sharpened too by the Koreans at the nail salon, they're like knives!" We laughed nonstop for about 5 mins straight. Maybe you had to be there, but I thought it was hilarious. :-)

A word to the wise, if you're going to get your nails sharpened, wear socks. LOL

Charlotte's Knocked up!

2007-09-20T16:13:00.000-04:00

Yayyyyy Charlotte will be pregnant for the Sex & the City movie!

Pic above is from the filming which is already under way. I can't wait!

Is Britney Spears Rosie's long lost sister?

2007-09-19T13:59:00.000-04:00

Why I love Perez Hilton. LOL.

Celebrity gossip

2007-09-19T08:40:00.000-04:00

OJ "The Murderer" Simpson
OJ now has 10 felony counts against him .. each charge could put him in jail for 35 years each.
This has to be one of the stupidest people I have ever seen in my life. Gets away with MURDER and STILL manages to f**k that up! Karmas a bitch!

Judge orders random drug/booze testing for Britney Spears twice a week..
I give it 2 weeks until she fails and the kids are taken away from her. I mean come on, not even rehab helped. I say they take the kids away from both of them and add them to the Brad/Angelina tribe.

Jennifer Lopez is pregnant..
Confirmed today Marc Anthony and JLo are expecting. Now this I am actually happy about!!
I know they have been trying for awhile and correct me if I am wrong but I believe she has had a few miscarriages. Anyway, good for them! :-)

Never Forget, September 11, 2001

2007-09-11T09:09:00.001-04:00

Well, I'll never listen to or watch Whoopi Goldberg again

2007-09-05T09:09:00.000-04:00

I only wish that Joy Behar would have kicked her ass on the View...

LOS ANGELES (Reuters) - Outspoken comedian Whoopi Goldberg drew a scathing rebuke from animal rights activists on Tuesday for defending U.S. football star Michael Vick's role in dogfighting during her debut on ABC's talk show "The View."

"He's from the South, from the Deep South ... This is part of his cultural upbringing," Goldberg said of the Atlanta Falcons quarterback, whose recent fall from grace has been one of the most stunning in the history of U.S. sports.

Vick pleaded guilty last week to federal dogfighting charges, admitting he took part in an illegal, interstate enterprise known as Bad Newz Kennels and helped kill underperforming dogs.
The 27-year-old, who grew up in Virginia, faces up to five years in prison when sentenced in December. He has been suspended indefinitely by the National Football League.

"For a lot of people, dogs are sport," Goldberg said on the show. "Instead of just saying (Vick) is a beast and he's a monster, this is a kid who comes from a culture where this is not questioned."
Veteran "View" co-host Joy Behar took immediate issue with Goldberg.

"What part of the country is this? ... How about dog torturing and dog murdering?" she asked.
Goldberg's comments were denounced by Wayne Pacelle, president of the Humane Society of the United States, who disputed that dogfighting was a cultural fixture of the South or any other region.

"To suggest that there is some ethnic group or racial group or regional group that finds this acceptable is just not accurate," he told Reuters, adding that public opinion polls show opposition to dogfighting "is a universal value in America."

He noted that dogfighting is outlawed in all 50 states, and a felony in all but two -- Idaho and Wyoming.

The Oscar-winning actress' dogfighting remarks came on her first day as the new lead panelist on "The View," filling the seat vacated by actress and comedian Rosie O'Donnell in May.
Goldberg's debut signaled she was likely to continue the often-controversial dynamic O'Donnell brought to the show, which blends live chat, celebrity interviews and segments on fashion, health and lifestyles.

Love is in the air!

2007-09-04T16:07:00.000-04:00

Wow, I know 4 people that have gotten engaged within the past few weeks!
- Charlene and Al
- My friend Rosa
- Tom Savino and Chrissy
- My friend Nicole

I have warned them all NOT TO DO IT! Just kidding.. ok maybe not like when I find stinky socks on the bathroom floor. :-) Congratulations to all you love birds!

I hate my job day

2007-09-04T10:00:00.000-04:00

When you have a "I Hate My Job" day, try this:

On your way home from work, stop at your pharmacy and go to the thermometer section and purchase a rectal thermometer made by Johnson & Johnson. Be very sure you get this brand.

When you get home, lock your doors, draw the curtains and disconnect the phone so you will not be disturbed. Change into very comfortable clothing and sit in your favorite chair. Open the package and remove the thermometer. Now, carefully place it on a table or a surface so that it will not become chipped or broken.

Now the fun part begins. Take out the literature from the box and read it carefully. You will notice that in small print there is a statement:

"Every Rectal Thermometer made by Johnson & Johnson is personally tested".

Now, close your eyes and repeat out loud five times, "I am so glad I do not work in the thermometer quality control at Johnson & Johnson."

HAVE A NICE DAY AND REMEMBER, THERE IS ALWAYS SOMEONE ELSE WITH A JOB THAT IS MORE OF A PAIN IN THE ASS THAN YOURS!

NY Renaissance Fair

2007-09-03T16:00:00.000-04:00

Hmmm maybe an option for next weekend. :-)

Saturdays, Sundays & Labor Day Monday
30th Anniversary!
August 4 through September 23, 2007
10:00 AM - 7:00 PM

http://www.renfair.com/NY/index.php

Yay, Lisa Williams is back for another season!

2007-09-03T15:37:00.000-04:00

Lisa Williams: Life Among the Dead
Premieres October 12 at 9 pm et/pt

Wooooooo hoooooooo!!! Part 4

2007-09-01T15:57:00.001-04:00

Seeing these seems to be a Halloween tradition for me every year!

Halloween 2007 my review

2007-09-01T09:03:00.000-04:00

Let me first start off by saying I've had nightmares of Michael Myers since I've seen the original Halloween back in the 80's so I was not looking forward to seeing the remake but only did it for Tom Kraus. I did like the fact that Rob Zombie focused alot on the earlier years of Michael Myers and why he became the psychopath he was. Side note, It really made me think about how kids can turn out without a normal family life and upbringing. Ok maybe I'm looking into this too much, it's just a horror movie .. LOL. Anyway, once Michael Myers grew up, the movie spiraled downhill and fast. I didn't like any of the characters, especially the actress that played Laurie Strode (originally played by Jamie Lee Curtis). The original Halloween focused more on Halloween day and the characters he was following which all lead up to the Michael Myers killing spree on Halloween night. This more or less introduced the characters for 5 mins and before you knew it, they were dead. The John Carpenter Halloween was creepy and I think it was the music that had alot to do with it. The Rob Zombie Halloween only played the infamous Halloween theme twice throughout the whole movie and it was just sick, very very gory and brutal which is why I covered my eyes through most of it!

Rob Zombie's Halloween, 2 out of 5 stars

HAPPY BIRTHDAY ADELE!!!!!!!

2007-08-31T11:25:00.000-04:00

I know I'm a day early but Happy Birthday to my sexy, doesn't look over 30 aunt! We love you! xoxoxoxox

Dude, where's my car?

2007-08-31T10:55:00.000-04:00

Added to the Tom Kraus list!

There goes sleep for the next 3 nights

2007-08-31T08:15:00.000-04:00

Tom Kraus is making me go see the new Halloween with him today. I say today bc I refuse to see it after dark. Ahhhhhhh I hope there's different music and not the orginial Michael Myers theme. Funny, every time Mike Myers from the Yankees came out to pitch they played the same music and I'd run for my life!!

Looking forward to the nice long weekend!

2007-08-30T16:14:00.000-04:00

God this week has been hell. I'm so excited for the long weekend!! The weather is supposed to be great ... looking forward to those zeppoles Lisa (you better make sure they have them before we get there on Sunday!) LOL

Today I want a squirrel monkey

2007-08-30T16:13:00.000-04:00

I feel another Tom Kraus story coming on.....

2007-08-29T08:18:00.001-04:00

So, Tom has been in class for work for the past 2 days. He said the class was intense and he had alot of info thrown at him a short amount of time. So this morning as I'm getting ready for work, he tells me that they were discussing theories on how to solve a computer microchip problem that no one (not even the professor who taught the class) can figure out. Engineers from all over the world have been unsuccessful. Well, Tom tells me this morning he thinks he knows how to solve it, but he didn't want to say it in class bc if he's right, they patent his theory and he's a millionaire. His words this morning, "babe I have to research it alot more but I think I have it". My response was, "so I guess that's how you'll be spending your whole day today huh?" "No no no", he tells me, "but I have to research". Stay tuned family and friends. If engineers can't figure it out, I'm sure my husband can. LOL.

How much of a drama queen are you?

2007-08-28T16:37:00.001-04:00

I thought I was more of a drama queen but the test doesn't lie!

You are a Balanced Babe!

You're direct and to the point, but never dramatic
You've got the confidence to speak your mind to anyone
But you leave the theatrics to Hollywood
Level headed and emotionally stable, no wonder everyone loves you

How Much of a Drama Queen Are You?

Today I want a white Lion cub!

2007-08-28T09:23:00.000-04:00

The Magic Garden

2007-08-27T16:21:00.001-04:00

It's amazing the things you find on YouTube. God I LOVED this show! Carole and Paula in their funky outfits, the chuckle patch, the Magic Tree, the Story Box.. aahhhhh those were the good old days. I have to admit though, I'm scarred for life.. they NEVER said my name during the "Hello Song". : (

What kind of pet would you be?

2007-08-27T15:55:00.001-04:00

You Would Be a Pet Dog

You're friendly, loyal, and an all around good sport. People love to be near you.
You are very open with your feelings, and you're quite vocal in expressing them.
You are sincere and kind. You love many people - without any sort of agenda.

Why you would make a great pet: You're content to chill out with your friends

Why you would make a bad pet: You always find yourself getting into trouble

What you would love about being a dog: Running around and playing

What you would hate about being a dog: Being left home alone while everyone else is out having fun

What Kind of Pet Would You Be?

White hospital shoes

2007-08-27T14:50:00.001-04:00

I was telling Craig yesterday about the Tom Kraus list who then reminded me of Tom's white hospital shoes, or as Craig called them "Tom's nurse shoes". They were a cross between white Capezios and nurse shoes! I always threatened Tom that he was not allowed to wear them in public with me around but they had a way of sneaking on his feet as we were leaving the house.

Tom Kraus decided to mow the lawn one day wearing his nurse shoes and was shocked when they turned green. Thanks to his screw up the nurse shoes are resting in peace in that big shoe store up in the sky.

3 new ones!

2007-08-25T11:17:00.000-04:00

I remembered some more for the Tom Kraus memoir.

- Bulls aren't just found in Spain

- An early morning confrontation with the FBI

- Who says frozen food belongs in the freezer?

Yes Adele, one of these days I will start posting the story behind each title for those of you that don't know the stories. : )

In the words of Maury Povich, "The DNA results are in!"

2007-08-25T09:17:00.000-04:00

Genetic Sequence
Type: mtDNA Haplogroup: W
Your Mitochondrial HVR I Sequence: 16223T, 16292T, 16294T, 16519C
ATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCACCCCTCACCCACTAGGATACCAACAAACCTACCTATCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGACCACCATCCTCCGTGAAATCAATATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCCCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGCCATAAAGCCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATG
Key C Subsitution(transition) C Substitution(transversion) C Insertion _ Deletion

How to Interpret Your Results

Above is displayed the sequence of your mitochondrial genome that was analyzed in the laboratory. Your sequence is compared against the Cambridge Reference Sequence (CRS), which is the standard mitochondrial sequence initially determined by researchers at Cambridge, UK. The differences between your DNA and the CRS are highlighted, and these data allow researchers to reconstruct the migratory paths of your genetic lineage. Substitution (transition): a nucleotide base mutation in which a pyrimidine base (C or T) is exchanged for another pyrimidine, or a purine base (A or G) is replaced with another purine. This is the most common type of single point mutation. Substitution (transversion): a base substitution in which a pyrimidine base (C or T) is exchanged for a purine base (A or G), or vice versa. Insertion: a mutation caused by the insertion of at least one extra nucleotide base in the DNA sequence. Deletion: a mutation caused by the deletion of at least one extra nucleotide base from the DNA sequence.

Your Branch on the Human Family Tree
Your DNA results identify you as belonging to a specific branch of the human family tree called W.
The map above shows the direction that your maternal ancestors took as they set out from their original homeland in East Africa. While humans did travel many different paths during a journey that took tens of thousands of years, the lines above represent the dominant trends in this migration.
Over time, the descendants of your ancestors spread throughout the Near East and gave rise to many groups that went on to inhabit much of northern Europe. But before we can take you back in time and tell their stories, we must first understand how modern science makes this analysis possible.

How DNA Can Help
(To follow along, click See Your DNA Analysis above to view the data produced from your cheek scraping.)
The string of 569 letters shown above is your mitochondrial sequence, with the letters A, C, T, and G representing the four nucleotides—the chemical building blocks of life—that make up your DNA. The numbers at the top of the page refer to the positions in your sequence where informative mutations have occurred in your ancestors, and tell us a great deal about the history of your genetic lineage.
Here's how it works. Every once in a while a mutation—a random, natural (and usually harmless) change—occurs in the sequence of your mitochondrial DNA. Think of it as a spelling mistake: one of the "letters" in your sequence may change from a C to a T, or from an A to a G.
(Explore the Genetics Overview to learn more about population genetics.)
After one of these mutations occurs in a particular woman, she then passes it on to her daughters, and her daughters' daughters, and so on. (Mothers also pass on their mitochondrial DNA to their sons, but the sons in turn do not pass it on.)
Geneticists use these markers from people all over the world to construct one giant mitochondrial family tree. As you can imagine, the tree is very complex, but scientists can now determine both the age and geographic spread of each branch to reconstruct the prehistoric movements of our ancestors.
By looking at the mutations that you carry, we can trace your lineage, ancestor by ancestor, to reveal the path they traveled as they moved out of Africa. Our story begins with your earliest ancestor. Who was she, where did she live, and what is her story?
(Click Explore Your Route Map on the right side of the page to return to the map showing your haplogroup's ancestral journey.)

Your Ancestral Journey: What We Know Now
We will now take you back through the stories of your distant ancestors and show how the movements of their descendants gave rise to your mitochondrial lineage.
Each segment on the map above represents the migratory path of successive groups that eventually coalesced to form your branch of the tree. We start with your oldest ancestor, "Eve," and walk forward to more recent times, showing at each step the line of your ancestors who lived up to that point.

Mitochondrial Eve: The Mother of Us All
Ancestral Line: "Mitochondrial Eve"
Our story begins in Africa sometime between 150,000 and 170,000 years ago, with a woman whom anthropologists have nicknamed "Mitochondrial Eve."
She was awarded this mythic epithet in 1987 when population geneticists discovered that all people alive on the planet today can trace their maternal lineage back to her.
But Mitochondrial Eve was not the first female human. Homo sapiens evolved in Africa around 200,000 years ago, and the first hominids—characterized by their unique bipedal stature—appeared nearly two million years before that. Yet despite humans having been around for almost 30,000 years, Eve is exceptional because hers is the only lineage from that distant time to survive to the present day.
Which begs the question, "So why Eve?"
Simply put, Eve was a survivor. A maternal line can become extinct for a number of reasons. A woman may not have children, or she may bear only sons (who do not pass her mtDNA to the next generation). She may fall victim to a catastrophic event such as a volcanic eruption, flood, or famine, all of which have plagued humans since the dawn of our species.
None of these extinction events happened to Eve's line. It may have been simple luck, or it may have been something much more. It was around this same time that modern humans' intellectual capacity underwent what author Jared Diamond coined the Great Leap Forward. Many anthropologists believe that the emergence of language gave us a huge advantage over other early human species. Improved tools and weapons, the ability to plan ahead and cooperate with one another, and an increased capacity to exploit resources in ways we hadn't been able to earlier, all allowed modern humans to rapidly migrate to new territories, exploit new resources, and outcompete and replace other hominids, such as the Neandertals.
It is difficult to pinpoint the chain of events that led to Eve's unique success, but we can say with certainty that all of us trace our maternal lineage back to this one woman.

The L Haplogroups: The Deepest Branches
Ancestral line: "Eve" > L1/L0
Mitochondrial Eve represents the root of the human family tree. Her descendents, moving around within Africa, eventually split into two distinct groups, characterized by a different set of mutations their members carry.
These groups are referred to as L0 and L1, and these individuals have the most divergent genetic sequences of anybody alive today, meaning they represent the deepest branches of the mitochondrial tree. Importantly, current genetic data indicates that indigenous people belonging to these groups are found exclusively in Africa. This means that, because all humans have a common female ancestor, "Eve," and because the genetic data shows that Africans are the oldest groups on the planet, we know our species originated there.
Haplogroups L1 and L0 likely originated in East Africa and then spread throughout the rest of the continent. Today, these lineages are found at highest frequencies in Africa's indigenous populations, the hunter-gatherer groups who have maintained their ancestors' culture, language, and customs for thousands of years.
At some point, after these two groups had coexisted in Africa for a few thousand years, something important happened. The mitochondrial sequence of a woman in one of these groups, L1, mutated. A letter in her DNA changed, and because many of her descendants have survived to the present, this change has become a window into the past. The descendants of this woman, characterized by this signpost mutation, went on to form their own group, called L2. Because the ancestor of L2 was herself a member of L1, we can say something about the emergence of these important groups: Eve begat L1, and L1 begat L2. Now we're starting to move down your ancestral line.

Haplogroup L2: West Africa
Ancestral line: "Eve" > L1/L0 > L2
L2 individuals are found in sub-Saharan Africa, and like their L1 predecessors, they also live in Central Africa and as far south as South Africa. But whereas L1/L0 individuals remained predominantly in eastern and southern Africa, your ancestors broke off into a different direction, which you can follow on the map above.
L2 individuals are most predominant in West Africa, where they constitute the majority of female lineages. And because L2 individuals are found at high frequencies and widely distributed along western Africa, they represent one of the predominant lineages in African-Americans. Unfortunately, it is difficult to pinpoint where a specific L2 lineage might have arisen. For an African-American who is L2—the likely result of West Africans being brought to America during the slave trade—it is difficult to say with certainty exactly where in Africa that lineage arose.
Fortunately, collaborative sampling with indigenous groups is currently underway to help learn more about these types of questions and to possibly bridge the gap that was created during those transatlantic voyages hundreds of years ago.

Haplogroup L3: Out of Africa
Ancestral line: "Eve" > L1/L0 > L2 > L3
Your next signpost ancestor is the woman whose birth around 80,000 years ago began haplogroup L3. It is a similar story: an individual in L2 underwent a mutation to her mitochondrial DNA, which was passed onto her children. The children were successful, and their descendants ultimately broke away from the L2 clan, eventually separating into a new group called L3. You can see above that this has revealed another step in your ancestral line.
While L3 individuals are found all over Africa, including the southern reaches of sub-Sahara, L3 is important for its movements north. You can follow this movement of the map above, seeing first the expansions of L1/L0, then L2, and followed by the northward migration of L3.
Your L3 ancestors were significant because they are the first modern humans to have left Africa, representing the deepest branches of the tree found outside of that continent.
Why would humans have first ventured out of the familiar African hunting grounds and into unexplored lands? It is likely that a fluctuation in climate may have provided the impetus for your ancestors' exodus out of Africa.
The African Ice Age was characterized by drought rather than by cold. Around 50,000 years ago the ice sheets of northern Europe began to melt, introducing a period of warmer temperatures and moister climate in Africa. Parts of the inhospitable Sahara briefly became habitable. As the drought-ridden desert changed to savanna, the animals your ancestors hunted expanded their range and began moving through the newly emerging green corridor of grasslands. Your nomadic ancestors followed the good weather and plentiful game northward across this Saharan Gateway, although the exact route they followed remains to be determined.
Today, L3 individuals are found at high frequencies in populations across North Africa. From there, members of this group went in a few different directions. Some lineages within L3 testify to a distinct expansion event in the mid-Holocene that headed south, and are predominant in many Bantu groups found all over Africa. One group of individuals headed west and is primarily restricted to Atlantic western Africa, including the islands of Cabo Verde.
Other L3 individuals, your ancestors, kept moving northward, eventually leaving the African continent completely. These people currently make up around ten percent of the Middle Eastern population, and gave rise to two important haplogroups that went on to populate the rest of the world.

Haplogroup N: The Incubation Period
Ancestral line: "Eve" > L1/L0 > L2 > L3 > N
Your next signpost ancestor is the woman whose descendants formed haplogroup N. Haplogroup N comprises one of two groups that were created by the descendants of L3.
The first of these groups, M, was the result of the first great wave of migration of modern humans to leave Africa. These people likely left the continent across the Horn of Africa near Ethiopia, and their descendants followed a coastal route eastward, eventually making it all the way to Australia and Polynesia.
The second great wave, also of L3 individuals, moved north rather than east and left the African continent across the Sinai Peninsula, in present-day Egypt. Also faced with the harsh desert conditions of the Sahara, these people likely followed the Nile basin, which would have proved a reliable water and food supply in spite of the surrounding desert and its frequent sandstorms.
Descendants of these migrants eventually formed haplogroup N. Early members of this group lived in the eastern Mediterranean region and western Asia, where they likely coexisted for a time with other hominids such as Neandertals. Excavations in Israel's Kebara Cave (Mount Carmel) have unearthed Neandertal skeletons as recent as 60,000 years old, indicating that there was both geographic and temporal overlap of these two hominids.
Some members bearing mutations specific to haplogroup N formed many groups of their own which went on to populate much of the rest of the globe. These descendants are found throughout Asia, Europe, India, and the Americas. However, because almost all of the mitochondrial lineages found in the Near East and Europe descend from N, it is considered a western Eurasian haplogroup.
After several thousand years in the Near East, members of your group began moving into unexplored nearby territories, following large herds of migrating game across vast plains. These groups broke into several directions and made their way into territories surrounding the Near East. Today, haplogroup N individuals who headed west are prevalent in Turkey and the eastern Mediterranean, they are found further east in parts of Central Asia and the Indus Valley of Pakistan and India. Descendants of these people eventually went on to populate the rest of Europe, and today comprise the most frequent mitochondrial lineages found there.

Haplogroup N1: A New Tribe Is Formed
Ancestral line: "Eve" > L1/L0 > L2 > L3 > N > N1
Your genetic lineage places you in one of the subgroups of N, known as N1. In addition to a wide geographic distribution similar to that of N, your haplogroup is significant because its members constitute one of the four major Ashkenazi Jewish founder lineages.
The term "Ashkenazi" refers to Jews of mainly central and eastern European ancestry. Most historical records indicate that the founding of the Ashkenazi Jewry took place in the Rhine Basin and subsequently underwent vast population expansions. In more recent times, the Ashkenazi population was estimated at approximately 25,000 individuals around 1300 A.D., whereas that number had increased to about 8,500,000 individuals by the turn of the twentieth century.
Around half of all Ashkenazi Jews trace their mitochondrial lineage back to one of four women, and your haplogroup N1 represents one of those lineages. N1 is seldom found in populations of non-Ashkenazi Jews. While it is virtually absent in Europeans, it appears at frequencies of roughly three percent or higher in those from the Levant, Arabia, and Egypt. This indicates a strong genetic role in the Ashkenazi founder event, which likely occurred in the Near East.
Today, haplogroup N1 is the second most common in Ashkenazi Jews and today is shared by around 800,000 people.

Haplogroup W: Your Branch on the Tree
Ancestral line: "Eve" > L1/L0 > L2 > L3 > N > W
We finally arrive at your own clan, a group of individuals who descend from a woman in the N branch of the tree. This woman was the common ancestor of what can be described as a western Eurasian lineage, the descendants of whom live in high frequencies in northern Europe and northern Eurasia.
As we have seen from haplogroup N, descendants from this western Eurasian lineage used the Near East as a "home base" of sorts, radiating from that region to populate much of the rest of the world. Today, members in the Near East belonging to your haplogroup W have more divergent lineages than those found in northern Europe, indicating a greater time in the Near East for those lineages to accumulate mutations.
Therefore, early members of your particular haplogroup likely moved north across the Caucasus, their lineages being carried into Europe for the first time during the middle Upper Paleolithic.
This wave of migration into Western Europe marked the appearance and spread of what archaeologists call the Aurignacian culture. The culture is distinguished by significant innovations in methods of manufacturing tools, standardization of tools, and a broader set of tool types, such as end-scrapers for preparing animal skins and tools for woodworking.
In addition to stone, the first modern humans to reach Europe used bone, ivory, antler, and shells as part of their tool kit. Bracelets and pendants made of shells, teeth, ivory, and carved bone appear at many sites. Jewelry, often an indication of status, suggests a more complex social organization was beginning to develop.
Today, only about ten percent of the mitochondrial lineages found in Europe reflect the original early Upper Paleolithic movements into the continent, and about 20 percent reflect the more recent Neolithic movements. The rest of the European mtDNA—including your own lineage—are the result of migrations into Europe during the middle Upper Paleolithic around 25,000 year ago. These took part in the post-glacial expansions around 15,000 years ago as the ice sheets receded during the late Upper Paleolithic.

Anthropology vs. Genealogy
DNA markers require a long time to become informative. While mutations occur in every generation, it requires at least hundreds—normally thousands—of years for these markers to become windows back into the past, signposts on the human tree.
Still, our own genetic sequences often reveal that we fall within a particular sub-branch, a smaller, more recent branch on the tree.
While it may be difficult to say anything about the history of these sub-groups, they do reveal other people who are more closely related to us. It is a useful way to help bridge the anthropology of population genetics with the genealogy to which we are all accustomed.
One of the ways you can bridge this gap is to compare your own genetic lineage to those of people living all over the world. Mitosearch.org is a database that allows you to compare both your genetic sequence as well as your surname to those of thousands of people who have already joined the database. This type of search is a valuable way of inferring population events that have occurred in more recent times (i.e., the past few hundred years).

Looking Forward (Into the Past): Where Do We Go From Here?
Although the arrow of your haplogroup currently ends across Northern Europe and Western Siberia, this isn't the end of the journey for haplogroup W. This is where the genetic clues get murky and your DNA trail goes cold. Your initial results shown here are based upon the best information available today—but this is just the beginning.
A fundamental goal of the Genographic Project is to extend these arrows further toward the present day. To do this, Genographic has brought together ten renowned scientists and their teams from all over the world to study questions vital to our understanding of human history. By working together with indigenous peoples around the globe, we are learning more about these ancient migrations.

Help Us Find More Clues!
But there is another way that we will learn more about the past. By contributing your own results to the project, you will be allowed to participate anonymously in this ongoing research effort. This is important because it may contribute a great deal to our understanding of more recent human migrations. Click the yellow button below in the "Help Us Tell the Story" section of your results profile to learn more about this. It's quick, easy, and anonymous, but will help us further refine our analyses.

Don't Be a Stranger
Finally, keep checking these pages to follow along with the project and our latest findings; your results profile will be automatically updated to reflect any new information that may come to light based on the research.

How could we all forget???

2007-08-24T15:47:00.000-04:00

Thank you Kim for reminding me of one of the most POPULAR Tom Kraus stories in my family to date. Ladies and gentleman, just added to the list of stories is, "Tom Kraus buys property on the moon".

Movies, Movies, Movies

2007-08-24T12:10:00.000-04:00

Looking forward to seeing on DVD:
1) Zodiac
2) Perfect Stranger
3) Fracture
4) Blades of Glory
5) Vacancy
6) I think I love my wife

Looking forward to seeing in the movies, if not, I'll wait for the dvds.
1) The Nanny Diaries http://movies.yahoo.com/movie/1809355974/video
2) Superbad http://movies.yahoo.com/movie/1809765431/video
3) Good luck Chuck http://movies.yahoo.com/movie/1809784517/video/

Finally the one I DO NOT want to see bc I won't sleep for a week but Tom is making me see with him:
Halloween http://movies.yahoo.com/movie/1809784517/video

Michael Vick should be strung up by his balls

2007-08-24T12:03:00.000-04:00

I LOVE THIS PICTURE!!!!!!!

In this undated photo provided by Rochelle Steffen, a 6-year-old Weimaraner, named Monte, poses for a photo with a football card of Michael Vick in its mouth in Cape Girardeau, Mo. The remains are being auctioned on eBay. Steffen of Cape Girardeau, gave every Vick card she owned to her dogs and let them go to town on the images of the Atlanta Falcons quarterback who is scheduled to plead guilty to a federal dogfighting charge Monday.

How rare is your personality?

2007-08-24T09:54:00.000-04:00

Your Personality is Somewhat Rare (ESFP)

Your personality type is playful, charming, open minded, and energetic.

Only about 7% of all people have your personality, including 9% of all women and 5% of all men
You are Extroverted, Sensing, Feeling, and Perceiving.

How Rare Is Your Personality?

The infamous "WTF kind of pose is that??" pic

2007-08-24T09:35:00.001-04:00

So I'm sitting here looking through my pictures and break out in hysterics when I come across the famous "WTF kind of pose is that" pic. To the naked eye this pic looks fine, me (drunk of course) having a good time with my friends. But after examining closely you'll see something in the background. No that is not a beaver (what is up with his teeth here anyway)? It's the one and only Tom. Now the question you have to ask yourself is WTF is he doing? A new Richard Simmons work out he's trying to master? A new version of the YMCA perhaps? Whatever the case may be we can all agree on one thing, he looks flaming gay!

2 oldies but goodies added to the Tom Kraus story list

2007-08-24T09:29:00.000-04:00

How could we forget the 2 famous Tom Kraus stories I just added???

- Didn't mom tell you never to play with Ouija Boards?

- The ghost of an old lady seduces Tom Kraus

Uh oh .....

2007-08-23T13:58:00.001-04:00

You Failed Your Driver's Test

You only got 6/10 correct.
If you have a driver's license, it needs to be revoked!

Are You a Good Driver?

2008 Kraus lovefest weekend

2007-08-23T11:29:00.000-04:00

OK so I'm already trying to plan our annual Tom Kraus bday/Jeannie bday/Vday weekend. This year we did an overnight trip in the city, saw Beauty and the Beast on Broadway, and went to dinner. I was thinking that this year I'd like to do a cabin in the Catskills .. Hot chocolate, snuggling in front of the fireplace, sex on a bear skin rug (I'm sure there's a future Tom Kraus story there somewhere!) I've been wanting to attempt to ski (on a bunny trail of course, I don't want to pull a Sonny Bono). Do they allow you to rent skis or do you need your own? Anyway I'm pissed off bc all of these places require a 2 night weekend minimum. What kind of bullshit is that? Why can't I just do an overnight trip Friday into Saturday? If I do Sunday into Monday then Tom needs to take off 2 days, if I do Thursday into Friday then I have to take off 2 days. It's ridiculous I tell you... So if I decide to go this route I'll be paying at least $600 & that doesn't include skiing!! Ahhhhhhhhh! Suggestions?

Lisa....

2007-08-23T08:26:00.000-04:00

I expect you to start updating your blog again. We'd like to see pics and hear stories about Baby Lola.. Adele, I know you're with me on this one. Now let's all chant her name until she gives in, Lisa, Lisa, Lisa....

Recipe for Mozzarella salad

2007-08-21T16:16:00.000-04:00

Thanks to Kim for the recipe, I had it at her party on Saturday. Delicious!

6 cups day old Italian bread, torn into bite-size pieces
1/3 cup olive oil salt and pepper to taste
3 cloves garlic, minced
1/4 cup olive oil
2 tablespoons balsamic vinegar
4 medium ripe tomatoes, cut into wedges
3/4 cup sliced red onion
10 basil leaves, shredded
1/2 cup pitted and halved green olives
1 cup fresh mozzarella, cut into bite-size pieces

DIRECTIONS Preheat oven to 400 degrees F (200 degrees C). In a large bowl, toss bread with 1/3 cup olive oil, salt, pepper, and garlic. Lay bread on a baking sheet, and toast in the preheated oven until golden, about 5 to 10 minutes; allow to cool slightly. While the bread is in the oven, whisk together 1/4 cup of olive oil and balsamic vinegar. Gently toss together the bread, tomatoes, onion, basil, olives, and mozzarella cheese. Toss with the vinaigrette and let stand for 20 minutes before serving.

Google maps

2007-08-21T12:15:00.000-04:00

What did we do before the days of mapquest, Google maps, GPS?!?? As I sit at my desk on this rainy Tuesday morning, I get a call from Lisa who has been driving around aimlessly for a half hour trying to get to her destination that's no more than 5 mins from her house (yes Lisa it is funny now that it's over). With the help of technology (cell phones and the internet) and her brilliant niece, Lisa, Grandma, and Lola have successfully arrived at their destination. Once again, big ups to Google Maps! Now call me and hire me Google!

A mama's love

2007-08-21T08:46:00.000-04:00

Does anyone get the feeling that I love animals more than I do most people? LOL .. I loved this pic and I love the look on the mama's face. It reminded me of me with my Annie. :-)

Anak, a 31-year-old Orang Utan, holds her five-day-old baby Apie in her arms in Ouwehands
Zoo in Rhenen, central Netherlands, July 31, 2007. The baby was born in captivity at the zoo. The zoo participates in the European Endangered Species Programme (EEP) , a European breeding program to save the endangered Orang Utans from extinction.

What city do you belong in?

2007-08-21T08:37:00.001-04:00

You Belong in Rome

You're a big city soul with a small town heart
Which is why you're attracted to the romance of Rome
Strolling down picture perfect streets, cappuccino in hand
And gorgeous Italian people - could life get any better?

What City Do You Belong In?

Survey tag

2007-08-20T16:16:00.000-04:00

FIVE THINGS I WAS DOING TEN YEARS AGO
1. Ring shopping for my engagement ring
2. living with my inlaws (ack)
3. not working for IBM yet, ahhh the good old days
4. having sex more often
5. obsessed with Titanic

FIVE FAVORITE SNACK FOOD
1. chocolate chip cookies
2. potato chips
3. ice cream
4. chocolate
5. popcorn

FIVE SONGS I KNOW THE WORDS TO
1. My wedding song, This I promise you by N Sync
2. I need love by LL Cool J
3. New York New York by Frank Sinatra
4. Spring Love by Stevie B
5. Ice Box by Omarion

FIVE THINGS I WOULD DO IF I WAS A MILLIONAIRE
1. buy a new house locally
2. buy a house in Italy
3. give money to family and friends
4. open an animal shelter
5. fly all my ladies to the Caribbean for a week of pampering, slumber party bitches!

FIVE BAD HABITS
1. snapping my gum
2. zone out when some people talk to me (Adele the 2 of us are probably never paying attention when we have a conversation! LOL)
3. cursing like a truck driver
4. watch too much TV
5. tanning, I know its bad but I do it anyway!

FIVE THINGS I WILL NEVER WEAR AGAIN
1. acid wash jeans
2. big hair
3. Members Only jacket
4. my wedding dress
5. a diaper??

FIVE THINGS I LIKE TO DO
1. hang with my family and friends
2. get pedicures
3. go to the beach
4. go to the movies
5. see Derek Jeter in person and stare at his arse

FIVE PEOPLE I TAGG
1. LISA
2. JEANNINE
3. JANET
4. ????
5. ????

Hurricane Dean as seen from space

2007-08-20T16:08:00.001-04:00